ДНК аптамеры, связывающие сердечный тропонин I человека

Описание

Перевод названия: DNA APTAMERS BINDING CARDIAC TROPONIN I OF HUMAN

Тип публикации: патент

Год издания: 2020

Аннотация:

Изобретение относится к области биотехнологии и медицины, а именно к области ДНК аптамеров, способных специфично и с высоким сродством связываться с сердечным тропонином I человека. Основными областями применения ДНК-аптамеров к сердечному тропонину I являются клинические исследования, медицинская диагностика инфаркта миокарда, в том числе создание высокочувствительных и высокоэффективных систем для детекции сердечного тропонина I. ДНК аптамеры, связывающие сердечный тропонин I человека, представлены одноцепочечными ДНК. ДНК аптамер ТnАр2 имеет первичную последовательность 5'-GGCAGCAGGAAGACAAGACAGGCAGTGT CACGCGCTCAAGGGTGGAGGGGTCGGGG AGGTTGGTTCTGTGGTTGCTCTGT-3', отобран в результате позитивной селекции против нативного сердечного тропонина I человека и негативной селекции против человеческих сывороточного альбумина, сердечных тропонинов С и Т, миоглобина и креатинкиназы MB; ДНК аптамер TnAp2t1 имеет первичную последовательность 5'-AGACAAGACAGGCAGTGTCA CGCGCTCAAGGGTGGAGG GGTCGGGGAGGTTGGT-3', отобран в результате позитивной селекции против нативного сердечного тропонина I человека и негативной селекции против человеческих сывороточного альбумина, сердечных тропонинов С и Т, миоглобина и креатинкиназы MB и оптимизации последовательности аптамера ТnАр2; ДНК аптамер TnAp2t2 имеет первичную последовательность 5'-GGCAGTGTCACGCGCTCAAGG GTGGAGGGGTCGGGGAGGT-3', отобран в результате позитивной селекции против нативного сердечного тропонина I человека и негативной селекции против человеческих сывороточного альбумина, сердечных тропонинов С и Т, миоглобина и креатинкиназы MB и оптимизации последовательности аптамера ТnАр2; ДНК аптамер TnAp2t3 имеет первичную последовательность 5'-GCTCAAGGGTGGAGGGGTCGGGGAGGT-3', отобран в результате позитивной селекции против нативного сердечного тропонина I человека и негативной селекции против человеческих сывороточного альбумина, сердечных тропонинов С и Т, миоглобина и креатинкиназы MB и оптимизации последовательности аптамера ТnАр2; ДНК аптамер ТnАр12 имеет первичную последовательность 5'-GGCAGCAGGAAGACAAGACATCGGGAGGGAG GGAGGGCAGTCTAGTCTCATGTG TTTCCATGGTTCTGTGGTTGCTCTGT-3', отобран в результате позитивной селекции против нативного сердечного тропонина I человека и негативной селекции против человеческих сывороточного альбумина, сердечных тропонинов С и Т, миоглобина и креатинкиназы MB. Полученные ДНК аптамеры обладают способностью специфично и высокоафинно связываться с человеческим сердечным тропонином I, а также расширяется их ассортимент. 4 ил.

FIELD: medicine; biotechnology.

SUBSTANCE: invention refers to biotechnology and medicine, namely to a region of aptamer DNA capable of binding specifically to cardiac troponin I of a human specifically and with high affinity. Main applications of DNA-aptamers to cardiac troponin I are clinical studies, medical diagnostics of myocardial infarction, including creation of high-sensitive and highly effective systems for detecting cardiac troponin I. DNA aptamers binding cardiac troponin I are presented by single-stranded DNA. DNA aptamer TnAp2 has primary sequence 5'-GGCAGCAGGAAGACAAGACAGGCAGTGT CACGCGCTCAAGGGTGGAGGGGTCGGGG AGGTTGGTTCTGTGGTTGCTCTGT-3', selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB; DNA aptamer TnAp2t1 has primary sequence 5'-AGACAAGACAGGCAGTGTCA CGCGCTCAAGGGTGGAGG GGTCGGGGAGGTTGGT-3', is selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB and optimization of sequence of aptamer TnAp2; DNA aptamer TnAp2t2 has primary sequence 5'-GGCAGTGTCACGCGCTCAAGG GTGGAGGGGTCGGGGAGGT-3', is selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB and optimization of sequence of aptamer TnAp2; DNA aptamer TnAp2t3 has primary sequence 5'-GCTCAAGGGTGGAGGGGTCGGGGAGGT-3', selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB and optimization of sequence of aptamer TnAp2; DNA aptamer TnAp12 has primary sequence 5'-GGCAGCAGGAAGACAAGACATCGGGAGGGAG GGAGGGCAGTCTAGTCTCATGTG TTTCCATGGTTCTGTGGTTGCTCTGT-3', is selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB.

EFFECT: obtained DNA aptamers have specific and high-affinity binding to human cardiac troponin I, as well as their range of products.

1 cl, 4 dwg

Ссылки на полный текст

Вхождение в базы данных